The RF Map module can process any number of FastQ files, both from single-read or paired-end experiments. Reads are first pre-processed (trimmed and clipped), and mapped to the reference transcriptome.
The resulting SAM/BAM files can be then passed to the RF Count module.

Usage

To list the required parameters, simply type:

$ rf-map -h
Parameter Type Description
-b2 or --bowtie2 Uses Bowtie v2 for reads mapping (Default: Bowtie v1)
-p or --processors int Number of processors (threads) to use (Default: 1)
-wt or --working-threads int Number of working threads to use for each instance of SAMTools/Bowtie (Default: 1).
Note: RT Counter executes 1 instance of SAMTools/Bowtie for each processor specified by -p. At least -p <processors> * -wt <threads> processors are required.
-t or --tmp-dir string Path to a directory for temporary files creation (Default: /tmp)
Note: If the provided directory does not exist, it will be created
-o or --output-dir string Output directory for writing mapped reads in SAM/BAM format (Default: rf_map/)
-ow or --overwrite Overwrites the output directory if already exists
-nb or --no-bam Disables conversion of SAM files to BAM format
-b or --bowtie string Path to bowtie (or bowtie2) executable (Default: assumes bowtie/bowtie2 is in PATH)
-c or --cutadapt string Path to cutadapt executable (Default: assumes cutadapt is in PATH)
-s or --samtools string Path to samtools executable (Default: assumes samtools is in PATH)
Cutadapt options
-ca5 or --cutadapt-5adapter string Sequence of 5' adapter to clip (Default: CAAGTCTCAAGATGTCAGGCTGCTAG, Illumina Small RNA 5’ Adapter)
Note #1: Sequence of 5' adapter will be automatically reverse-complemented
Note #2: Multiple adapter sequences can be provided as a comma-separated list
-ca3 or --cutadapt-3adapter string Sequence of 3' adapter to clip (Default: TGGAATTCTCGGGTGCCAAGG, Illumina Small RNA 3’ Adapter)
Note: Multiple adapter sequences can be provided as a comma-separated list

-cl or --cutadapt-len | int | Minimum length to keep reads after clipping (≥10, Default: 25) -cm or --cutadapt-min-align | int | Minimum alignment in nt to adapter’s sequence (>0, Default: 1) -cp or --clipped | | Assumes that reads have been already clipped | | Mapping options -mp or --mapping-params | string | Manually specify additional aligner parameters (e.g. -mp "-n 2 -l 15")
Note: for a complete list of aligner's parameters, please check the aligner's documentation -mo or --manual-only | | Only uses manually specified aligner's parameters.
Any other parameter, except -bi (or --bowtie-index), will be ignored -bk or --bowtie-k | int | Reports up to this number of mapping positions for reads (Default: disabled) -ba or --bowtie-all | | Reports all mapping positions for reads (Default: disabled) -bnr or --bowtie-norc | | Maps only to transcript's sense strand (Default: both strands) -b5 or --bowtie-trim5 | int | Number of bases to trim from 5'-end of reads (≥0, Default: 0) -b3 or --bowtie-trim3 | int | Number of bases to trim from 3'-end of reads (≥0, Default: 0) -bi or --bowtie-index | string | Path to transcriptome reference index (see rf-index) | | Bowtie v1 options -bl or --bowtie-seedlen | int | Seed length (≥5, Default: 28) -bn or --bowtie-n | int | Use Bowtie mapper in -n mode (0-3, Default: 2)
Note: in -n mode, Bowtie admits no more than -bn mismatches in the seed -bv or --bowtie-v | int | Use Bowtie mapper in -v mode (0-3, Default: disabled)
Note: in -v mode, Bowtie admits no more than -bv mismatches in the entire read (Phred quality ignored) -bm or --bowtie-max | int | Discard read if more than this number of alignments exist (Default: 1) -bc or --bowtie-chunkmbs | int | Maximum MB of RAM for best-first search frames (Default: 128) | | Bowtie v2 options -bl or --bowtie-seedlen | int | Seed length (3 ≤ l ≤ 32, Default: 22) -bN or --bowtie-N | int | Bowtie seed mismatches (0-1, Default: 0) -bD or --bowtie-D | int | Maximum number of seed extension attempts (≥0, Default: 15) -bR or --bowtie-R | int | Maximum number of re-seeding attempts for reads with repetitive seeds (≥0, Default: 2) -bmp or --bowtie-mp | int[,int] | Maximum and minimum mismatch penalities (≥0, Default: 6,2) -bdp or --bowtie-dpad | int | Number of extra reference bases included on sides of the DP table (≥0, Default: 15) -bdg or --bowtie-rdg | int[,int] | Read's gap open and extend penalities (≥0, Default: 5,3) -bfg or --bowtie-rfg | int[,int] | Reference's gap open and extend penalities (≥0, Default: 5,3) -bs or --bowtie-softclip | | Enables local alignment mode (Default: entire read must align) -bma or --bowtie-ma | int | Match bonus in local alignment mode (Default: 2)

Important

When using Bowtie v1, Bowtie's --best and --strata parameters are automatically added. Please check Bowtie v1 documentation for additional information.

Important

When using Bowtie v2 with paired-end reads, Bowtie's --no-mixed parameter is automatically added to discard those reads for which only one of the two mates can be mapped. Please check Bowtie v2 documentation for additional information.