1. PARS

1. Download and decompress SRA files to FastQ format using the NCBI SRA Toolkit:

# Download/decompress reads
$ fastq-dump -A SRR972714       # Nuclease S1 sample
$ fastq-dump -A SRR972715       # RNase V1 sample

# Rename files
$ mv SRR972714.fastq S1.fastq
$ mv SRR972715.fastq V1.fastq 


2. Prepare the reference index using rf-index. To build the RefSeq gene annotation for Homo sapiens (hg38 assembly), simply type:

$ rf-index -g hg38 -a refGene 

This will build a Bowtie v1 reference index. To use Bowtie v2, simply append the -b2 (or --bowtie2) parameter to the previous command:

$ rf-index -g hg38 -a refGene --bowtie2 

A folder named "hg38_refGene_bt/" (or "hg38_refGene_bt2/" in case Bowtie v2 is used) will be created in the current working directory.

3. Map reads to reference using rf-map (Note: according to the GEO dataset's page, the last 51 nt of reads should be trimmed):

# Reads will be trimmed by 51 nt from their 3'-end, an mapped to transcripts
# sense strand only, allowing a maximum of 20 equally scoring alignments

$ rf-map -bnr -b3 51 -bm 20 -bi hg38_refGene_bt/hg38_refGene S1.fastq V1.fastq

To use Bowtie v2, simply append the -b2 (or --bowtie2) parameter to the previous command:

$ rf-map -bnr -b3 51 -bm 20 -bi hg38_refGene_bt2/hg38_refGene S1.fastq V1.fastq --bowtie2


4. Count RT-stops in both samples using rf-count:

$ rf-count -nm -f hg38_refGene_bt/hg38_refGene.fa rf_map/*.bam


5. Normalize data using rf-norm:

# Data will be normalized by default using Ding et al., 2014 
# scoring method, and 2-8% normalization

$ rf-norm -u rf_count/V1.rc -t rf_count/S1.rc -i rf_count/index.rci


6. Perform transcriptome-wide inference of secondary structures usign rf-fold:

# Inference will be performed by default according to Deigan et al., 2009,
# using the ViennaRNA algorithm

$ rf-fold -g S1_vs_V1_norm/

A folder named "structurome/" will be generated, containing two subdirectories:

- "structures/": inferred structures in dot-bracket notation
- "images/": structure representations in Postscript format

2. DMS-MaPseq

1. Download and decompress SRA file to FastQ format using the NCBI SRA Toolkit:

# Download/decompress reads
$ fastq-dump -A SRR3929629      # S. cerevisiae Tagmented rRNA

# Rename file
$ mv SRR3929629.fastq Sc_Tag_rRNA.fastq 


2. Prepare the reference index using rf-index. To download the pre-built Bowtie v2 Saccharomyces cerevisiae ribosomal RNAs reference index, simply type:

$ rf-index -pb 3 --bowtie2

3. Map reads to reference using rf-map:

$ rf-map -ca3 CTGTCTCTTATACACATCT -bs -bi Scerevisiae_rRNA_bt2/reference Sc_Tag_rRNA.fastq --bowtie2


4. Count mutations using rf-count:

$ rf-count -m -nm -f Scerevisiae_rRNA_bt2/reference.fa rf_map/Sc_Tag_rRNA.bam


5. Normalize data using rf-norm:

# Data will be normalized on A/C residues only, using Zubradt et al., 2016 
# scoring method, and 90% Winsorising

$ rf-norm -t rf_count/Sc_Tag_rRNA.rc -i rf_count/index.rci -sm 4 -nm 2 -rb AC

A folder named "Sc_Tag_rRNA_norm/" will be generated, containing one XML file for each analyzed transcript.

3. m6A-seq

1. Download and decompress SRA files to FastQ format using the NCBI SRA Toolkit:

# Download/decompress reads
$ fastq-dump -A SRR456551       # m6A IP sample
$ fastq-dump -A SRR456555       # Input sample

# Rename files
$ mv SRR456551.fastq IP.fastq
$ mv SRR456555.fastq Input.fastq 


2. Prepare the reference index using rf-index. To build the Homo sapiens mRNAs reference index, simply type:

$ rf-index -g hg19 -a refGene 

This will download a Bowtie v1 reference index. To use Bowtie v2, simply append the -b2 (or --bowtie2) parameter to the previous command:

$ rf-index -g hg19 -a refGene --bowtie2 

A folder named "hg19_refGene_bt/" (or "hg19_refGene_bt2/" in case Bowtie v2 is used) will be created in the current working directory.

3. Map reads to reference using rf-map:

$ rf-map -ca3 GATCGGAAGAGCGGTTCAGCAG -bm 20 -bi hg19_refGene_bt/hg19_refGene Input.fastq IP.fastq

To use Bowtie v2, simply append the -b2 (or --bowtie2) parameter to the previous command:

$ rf-map -ca3 GATCGGAAGAGCGGTTCAGCAG -bm 20 -bi hg19_refGene_bt/hg19_refGene Input.fastq IP.fastq --bowtie2


4. Calculate read coverage in both samples using rf-count:

$ rf-count -nm -r -co -f hg19_refGene_bt/hg19_refGene.fa rf_map/*.bam


5. Call m6A peaks using rf-peakcall:

$ rf-peakcall -c rf_count/Input.rc -I rf_count/IP.rc -i rf_count/index.rci -e 2.5

A BED file named "IP_vs_Input.bed" will be generated, containing the called peaks.

4. 2OMe-seq

1. Download and decompress SRA files to FastQ format using the NCBI SRA Toolkit:

# Download/decompress reads
$ fastq-dump -A SRR2414087      # High dNTP (1 mM) sample
$ fastq-dump -A SRR2414088      # Low dNTP (4 nM) sample

# Rename files
$ mv SRR2414087.fastq HeLa_1mM_dNTP.fastq
$ mv SRR2414088.fastq HeLa_4nM_dNTP.fastq 


2. Prepare the reference index using rf-index. To download the pre-built Homo sapiens ribosomal RNAs reference index, simply type:

$ rf-index -pb 1 

This will download a Bowtie v1 reference index. To use Bowtie v2, simply append the -b2 (or --bowtie2) parameter to the previous command:

$ rf-index -pb 1 --bowtie2 

A folder named "Hsapiens_rRNA_bt/" (or "Hsapiens_rRNA_bt2/" in case Bowtie v2 is used) will be created in the current working directory.

3. Map reads to reference using rf-map:

$ rf-map -b5 5 -bi Hsapiens_rRNA_bt/reference HeLa_1mM_dNTP.fastq HeLa_4nM_dNTP.fastq

To use Bowtie v2, simply append the -b2 (or --bowtie2) parameter to the previous command:

$ rf-map -b5 5 -bi Hsapiens_rRNA_bt/reference HeLa_1mM_dNTP.fastq HeLa_4nM_dNTP.fastq --bowtie2


4. Count RT-stops in both samples using rf-count:

$ rf-count -r -fh -f Hsapiens_rRNA_bt/reference.fa rf_map/*.bam


5. Calculate per-base score and ratio using rf-modcall:

$ rf-modcall -u rf_count/HeLa_1mM_dNTP.rc -t rf_count/HeLa_4nM_dNTP.rc -i rf_count/index.rci

A folder named "HeLa_4nM_dNTP_vs_HeLa_1mM_dNTP/" will be generated, containing one XML file for each analyzed transcript.